Review





Similar Products

pcr conditions  (New England Biolabs)
99
New England Biolabs pcr conditions
Pcr Conditions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr conditions/product/New England Biolabs
Average 99 stars, based on 1 article reviews
pcr conditions - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
pcr condition  (Jackson Laboratory)
86
Jackson Laboratory pcr condition
Pcr Condition, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr condition/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
pcr condition - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
standard oligo pool pcr condition  (Twist Bioscience)
86
Twist Bioscience standard oligo pool pcr condition
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Standard Oligo Pool Pcr Condition, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/standard oligo pool pcr condition/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
standard oligo pool pcr condition - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
pcr thermal cycling conditions  (Bio-Rad)
99
Bio-Rad pcr thermal cycling conditions
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Pcr Thermal Cycling Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr thermal cycling conditions/product/Bio-Rad
Average 99 stars, based on 1 article reviews
pcr thermal cycling conditions - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc  (Jackson Laboratory)
86
Jackson Laboratory paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Paper N A Kras G12d Conditional Pcr Primer 1 Gtctttccccagcacagtgc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
pcr conditions  (Eppendorf AG)
96
Eppendorf AG pcr conditions
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Pcr Conditions, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr conditions/product/Eppendorf AG
Average 96 stars, based on 1 article reviews
pcr conditions - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
pcr conditions  (Jackson Laboratory)
90
Jackson Laboratory pcr conditions
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Pcr Conditions, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr conditions/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
pcr conditions - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
pcr cycling conditions  (BGI Shenzhen)
90
BGI Shenzhen pcr cycling conditions
Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
Pcr Cycling Conditions, supplied by BGI Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr cycling conditions/product/BGI Shenzhen
Average 90 stars, based on 1 article reviews
pcr cycling conditions - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

Journal: Nucleic Acids Research

Article Title: A versatile platform for combinatorial antibody library cloning and NGS-based quality control with high accuracy

doi: 10.1093/nar/gkaf1001

Figure Lengend Snippet: Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

Article Snippet: Additionally, a standard oligo pool PCR condition was included for comparison, following Twist Bioscience’s oligo pool PCR protocol (10 ng of oligo pool in a 25 μl PCR reaction, 10 cycles).

Techniques: Cloning, Biomarker Discovery, Plasmid Preparation, Sequencing